Browsing by Title
Now showing items 3369-3388 of 7879
-
Impacts of climate variability and drought on surface water resources in sub-saharan africa using remote sensing: A review
(Remote Sensing, 2022)Climate variability and recurrent droughts have caused remarkable strain on water resources in most regions across the globe, with the arid and semi-arid areas being the hardest hit. The impacts have been notable on surface ... -
Impacts of eco-environmental quality, spatial configuration, and landscape connectivity of urban vegetation patterns on seasonal land surface temperature in Harare metropolitan city, Zimbabwe
(Taylor and Francis Group, 2022)The study examined the impact of eco-environmental quality conditions, spatial configurations and landscape connectivity of urban vegetation on seasonal land surface temperature (LST) in Harare, Zimbabwe between May and ... -
Impacts of groundwater and climate variability on terrestrial groundwater dependent ecosystems: A review of geospatial assessment approaches and challenges and possible future research directions
(Taylor and Francis Group, 2022)Terrestrial groundwater dependent vegetation (TGDV) are crucialecosystems which provide important goods and services such ascarbon sequestration, habitat, water purification and aestheticbenefits in semi-arid environments. ... -
Impacts of plastic debris on biota and implications for human health: A South African perspective
(South African Assn. For The Advancement Of Science, 2020)Entanglement and ingestion of plastics are the main ecological impacts of marine plastic debris on marine biota, but indirect effects such as the transport of alien species and benthic smothering are also important to note. ... -
Impacts of the spatial configuration of built-up areas and urban vegetation on land surface temperature using spectral and local spatial autocorrelation indices
(Remote Sensing Letters, 2022)Understanding how the spatial configuration of land cover patterns of built-up areas and urban vegetation affect urban surface temperatures is crucial for improving the sustainability of cities as well as optimizing urban ... -
Impacts of tooth loss on ohrqol in an adult population in Cape Town, South Africa
(MPDI, 2021)Background: Tooth loss is an important component of the global burden of oral disease, greatly reducing the quality of life of those affected. Tooth loss can also affect diet and subsequent incidences of lifestyle diseases, ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Imperfect transition – local government reform in South Africa 1994-2012
(SUN Press, 2012)Local government is a mirror of the larger political and economic forces, cleavages and problems that are shaping South African society. It is these deeper fault lines in society, rather than the Zuma government’s ... -
An implant-supported auricular prosthesis: a team effort between two South African tertiary institutions
(South African Dental Association, 2002)Primary osseo-integration with cranio facial implants is so reliable that it may be considered routine. Arcu ri ef nl.' reported that the use of titan ium endosseous screw implants proved to be a successful, predictable, ... -
Implementation of a Psychosocial Support Intervention for Adolescents on Antiretroviral Treatment: Challenges and Experiences from Ehlanzeni District, South Africa
(SAGE Publications, 2022)Adolescents living with HIV (ALHIV) need support from family, peers and health workers to remain on antiretroviral therapy and achieve and sustain viral suppression. This paper qualitatively explores the implementation of ... -
The implementation of a risk based assessment approach by the South African Health pProducts Regulatory Authority (SAHPRA)
(Springer, 2023)An extensive backlog of pending regulatory decisions is one of the major historical challenges that the South African Health Products Regulatory Authority (SAHPRA) inherited from the Medicine Control Council (MCC). Revising ... -
Implementation of an intervention program to enhance student teachers’ active learning in transformation geometry
(SAGE Publications Inc, 2023)Active learning strategies are purported to be effective in enhancing students’ understanding of concepts that would otherwise be difficult to master through other strategies of mediating learning. This study forms part ... -
Implementation of groundwater protection measures, particularly resource directed measures in South Africa: a review paper
(Water Policy, 2021)This review paper on groundwater protection measures in South Africa focuses on the actual implementation of groundwater protection measures, in particular, the resource-directed measures (RDM) as described in Chapter 3 ... -
Implementation of Housing Rights in South Africa: Approaches and strategies
(Journal of Law and Social Policy, 2015)Ensuring access to adequate housing, especially for the poor and disadvantaged in society, including those faced with evictions and displacement, continues to be a global challenge. The situation remains critical in South ... -
Implementation of maternal and perinatal death reviews: A scoping review protocol
(BMJ Open, 2019)The Consolidated Framework for Implementation Research will inform the development of a theory-based conceptual framework for MPDSR implementation. The methodology for the scoping review will be guided by an adapted Arksey ... -
Implementation of the HiBalance training program for Parkinson’s disease in clinical settings: A feasibility study
(Wiley Open Access, 2018)BACKGROUND: Translating evidence into practice requires adaptation to facilitate the implementation of efficacious interventions. A novel highly challenging balance training program (HiBalance) was found to improve gait, ... -
Implementation, effectiveness and political context of comprehensive primary health care: preliminary findings of a global literature review
(CSIRO, 2008)Primary health care (PHC) is again high on the international agenda. It was the theme of The World Health Report in 2008, thirty years after the Alma-Ata Declaration, and has been the topic of a series of significant ... -
Implementing accountability and transparency in supranational organisations: a comparison of the European Union and the African Union, 2001-2020
(Journal of African Union Studies (JoAUS), 2021)Despite discernible efforts by African political leaders to serve their people since the demise of colonialism and apartheid, African institutions are generally claimed to be ineffective. This ... -
Implementing and Evaluating Community Health Worker-Led Cardiovascular Disease Risk Screening Intervention in Sub-Saharan Africa Communities: A Participatory Implementation Research Protocol
(MDPI, 2022)The increasing burden of non-communicable diseases (NCDs), particularly cardiovascular diseases (CVD) in low- and middle-income countries (LMICs) poses a considerable threat to public health. Community-driven CVD risk ...