Faculty of Natural Sciences
Browse by
Welcome to the scholarship of the Faculty of Natural Sciences.
The Faculty is developing a reputation as an important centre of research in South Africa. It equips graduates with solid academic and research skills and gives them the ability to succeed in the market place.
Electronic theses and dissertations are available in the Electronic Theses and Dissertations Repository .
News
South African institutions top THE Africa rankings pilot
Times Higher Education creates a top 15 table for Africa’s academies ahead of the inaugural THE Africa Universities Summit on 30-31 July
Sub-communities within this community
Recent Submissions
-
Characterization of four new compounds from protea cynaroides leaves and their tyrosinase inhibitory potential
(MDPI, 2022)Protea cynaroides (king protea) is a flowering plant that belongs to the Proteaceae family. This multi-stemmed shrub is the national flower of South Africa and has important economic and medicinal values. Traditionally, ... -
Comparative evaluation of pharmacy students’ knowledge and skills in maternal and child health: Traditional versus integrated curriculum
(MDPI, 2022): Reducing maternal and child mortality is a health priority in South Africa. Therefore, health professional education should produce graduates that can meet these needs. This study compared the maternal and child health ... -
To use face masks or not after Covid-19 vaccination? An impact analysis using mathematical modeling
(Frontiers Media, 2022)The question of whether to drop or to continue wearing face masks especially after being vaccinated among the public is controversial. This is sourced from the efficacy levels of COVID-19 vaccines developed, approved, ... -
First Observations of E-Region Near Range Echoes Partially Modulated by F-Region Traveling Ionospheric Disturbances Observed by the Same SuperDARN HF Radar
(Journal of Geophysical Research: Space Physics, 2022)We present the first observations from SuperDARN HF radar data of E-region Near Range Echoes (NREs) whose amplitudes are partially modulated by Medium-Scale Traveling Ionospheric Disturbances (MSTIDs) propagating in the ... -
Assessing accessibility and availability of portable water supply in selected communities of Lepelle-Nkumpi local municipality, Limpopo province of South Africa
(elsevier, 2022)In this study, we assessed the accessibility and availability of portable water supply in selected communities of the Lepelle-Nkumpi Local Municipality. A systematic random sampling method was used to select 49 households ... -
Electrochemiluminescence at 3D Printed Titanium Electrodes
(Frontiers Media SA, 2021)The fabrication and electrochemical properties of a 3D printed titanium electrode array are described. The array comprises 25 round cylinders (0.015 cm radius, 0.3 cm high) that are evenly separated on a 0.48 × 0.48 cm ... -
Effect of copper sulphate and cadmium chloride on non-human primate sperm function in vitro
(MDPI, 2021)Abstract: In order to address the large percentage of unexplained male infertility in humans, more detailed investigations using sperm functional tests are needed to identify possible causes for compromised fertility. Since ... -
Quantitative sperm characteristics of Tankwa goats with special reference to hyperactivated motility
(South African Society for Animal Science, 2020)Computer-assisted semen analysis (CASA) is an automated and objective method of evaluating structural (e.g. morphology) and functional sperm parameters (e.g. motility and hyperactivation). Sperm hyperactivation is essential ... -
Factors associated with glycemic control among South African adult residents of Mkhondo municipality living with diabetes mellitus
(Lippincott, Williams & Wilkins, 2020)This study examines the rate and the influencing factors of glycemic control among adult residents living with DM in Mkhondo Municipality of South Africa. In this cross-sectional study, 157 individuals attending care for ... -
Establishing a pharmacist–prescriber partnership in publicly funded primary healthcare clinics to optimise antibiotic prescribing in the Western Cape: An exploratory study
(AOSIS, 2020)Promoting evidence-based antibiotic prescribing through successful antimicrobial stewardship (AMS) programmes is critical to preserving the effectiveness of antibiotics for common infections in primary care. This requires ... -
Protect high seas biodiversity
(American Association for the Advancement of Science, 2021)The high seas—marine areas beyond national jurisdiction (1)—cover nearly half of Earth’s surface (2). The high seas support our planet in countless ways, from regulating the climate, to feeding millions of people, to ... -
The thousand-Pulsar-Array programme on MeerKAT - VI. Pulse widths of a large and diverse sample of radio pulsars
(Oxford, 2022)We present pulse width measurements for a sample of radio pulsars observed with the MeerKAT telescope as part of the Thousand-Pulsar-Array (TPA) programme in the MeerTime project. For a centre frequency of 1284 MHz, we ... -
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ... -
Cleaning foregrounds from single-dish 21 cm intensity maps with Kernel principal component analysis
(Oxford University Press, 2021)he high dynamic range between contaminating foreground emission and the fluctuating 21 cm brightness temperature field is one of the most problematic characteristics of 21 cm intensity mapping data. While these components ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Quantification and characterisation of microplastics ingested by selected juvenile fish species associated with mangroves in KwaZulu- Natal, South Africa
(Elsevier, 2020)Though the number studies on microplastic ingestion by fish is growing, data on fish species charac- teristic of the South African coastline are scarce. This study quantified and characterised (physically and chemically) ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Biological synthesis of gold and silver nanoparticles using leaf extracts of Crassocephalum rubens and their comparative in vitro antioxidant activities
(Elsevier, 2020)The use of plant and plant products in the synthesis of silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) is made possible because of the natural inherent phytochemicals responsible for the reduction of respective ... -
Phenolic content, antioxidant, cytotoxic and antiproliferative effects of fractions of Vigna subterraenea (L.) verdc from Mpumalanga, South Africa
(Elsevier, 2021)Consistent intake of legumes has been correlated with decreased possibility of developing colorectal cancer (CRC) due to the content of some phytochemicals like polyphenols. Bambara groundnut (BGN) is an underutilized ... -
Effect of landscape pattern and spatial configuration of vegetation patches on urban warming and cooling in Harare metropolitan city, Zimbabwe
(Bellweather Publishing, 2021)The spatial configuration of vegetation patches in the landscape has implications for the provision of ecosystem services, human adaptation to climate change, enhancement, or mitigation of urban heat island. Until recently, ...