Browsing Faculty of Natural Sciences by Title
Now showing items 1156-1175 of 2571
-
Impact of Rubin Observatory Cadence Choices on Supernovae Photometric Classification
(The Astrophysical Journal Supplement Series, 2023)The Vera C. Rubin Observatory’s Legacy Survey of Space and Time (LSST) will discover an unprecedented number of supernovae (SNe), making spectroscopic classification for all the events infeasible. LSST will thus rely on ... -
The impact of solar wind variability on pulsar timing
(EDP Sciences, 2021)Context. High-precision pulsar timing requires accurate corrections for dispersive delays of radio waves, parametrized by the dispersion measure (DM), particularly if these delays are variable in time. In a previous paper, ... -
The impact of sperm DNA damage in assisted conception and beyond: recent advances in diagnosis and treatment
(Elsevier, 2013)Sperm DNA damage is a useful biomarker for male infertility diagnosis and prediction of assisted reproduction outcomes. It is associated with reduced fertilization rates, embryo quality and pregnancy rates, and higher ... -
The Impact of Storage Time and Seasonal Harvesting on Levels of Sutherlandins and Sutherlandiosides in Lessertia frutescens
(Conference: Faculty of Community and Health Sciences 2nd Research Day, 2013)In South Africa, an estimate of 70% of the population frequently uses traditional medicine for their health care needs. The use of Lessertia frutescens (Figure 1,2) by various cultural groups dates back to the earlier ... -
The impact of the connectivity of the cosmic web on the physical properties of galaxies at its nodes
(Oxford University Press, 2019)We investigate the impact of the number of filaments connected to the nodes of the cosmic web on the physical properties of their galaxies using the Sloan Digital Sky Survey. We compare these measurements to the cosmological ... -
Impact of Varicocele Repair on Semen Parameters in Infertile Men: A Systematic Review and Meta-Analysis
(Korean Society for Sexual Medicine and Andrology, 2023)Purpose: Despite the significant role of varicocele in the pathogenesis of male infertility, the impact of varicocele repair (VR) on conventional semen parameters remains controversial. Only a few systematic reviews and ... -
The impact of wind scalings on stellar growth and the baryon cycle in cosmological simulations
(Oxford University Press, 2020)Many phenomenologically successful cosmological simulations employ kinetic winds to model galactic outflows. Yet systematic studies of how variations in kinetic wind scalings might alter observable galaxy properties are ... -
Impacts of an invasive alien Proteaceae on native plant species richness and vegetation structure
(South African Journal of Botany, 2021)The influence of invasive alien plants on plant community structure and above ground biomass in their novel range is poorly understood, as the magnitude and direction of these effects are often species and ecosystem specific. ... -
Impacts of climate variability and drought on surface water resources in sub-saharan africa using remote sensing: A review
(Remote Sensing, 2022)Climate variability and recurrent droughts have caused remarkable strain on water resources in most regions across the globe, with the arid and semi-arid areas being the hardest hit. The impacts have been notable on surface ... -
Impacts of eco-environmental quality, spatial configuration, and landscape connectivity of urban vegetation patterns on seasonal land surface temperature in Harare metropolitan city, Zimbabwe
(Taylor and Francis Group, 2022)The study examined the impact of eco-environmental quality conditions, spatial configurations and landscape connectivity of urban vegetation on seasonal land surface temperature (LST) in Harare, Zimbabwe between May and ... -
Impacts of groundwater and climate variability on terrestrial groundwater dependent ecosystems: A review of geospatial assessment approaches and challenges and possible future research directions
(Taylor and Francis Group, 2022)Terrestrial groundwater dependent vegetation (TGDV) are crucialecosystems which provide important goods and services such ascarbon sequestration, habitat, water purification and aestheticbenefits in semi-arid environments. ... -
Impacts of plastic debris on biota and implications for human health: A South African perspective
(South African Assn. For The Advancement Of Science, 2020)Entanglement and ingestion of plastics are the main ecological impacts of marine plastic debris on marine biota, but indirect effects such as the transport of alien species and benthic smothering are also important to note. ... -
Impacts of the spatial configuration of built-up areas and urban vegetation on land surface temperature using spectral and local spatial autocorrelation indices
(Remote Sensing Letters, 2022)Understanding how the spatial configuration of land cover patterns of built-up areas and urban vegetation affect urban surface temperatures is crucial for improving the sustainability of cities as well as optimizing urban ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
The implementation of a risk based assessment approach by the South African Health pProducts Regulatory Authority (SAHPRA)
(Springer, 2023)An extensive backlog of pending regulatory decisions is one of the major historical challenges that the South African Health Products Regulatory Authority (SAHPRA) inherited from the Medicine Control Council (MCC). Revising ... -
Implementation of groundwater protection measures, particularly resource directed measures in South Africa: a review paper
(Water Policy, 2021)This review paper on groundwater protection measures in South Africa focuses on the actual implementation of groundwater protection measures, in particular, the resource-directed measures (RDM) as described in Chapter 3 ... -
Implementing value chain analysis to investigate drivers and sustainability of Cape Town's informal economy of wild-harvested traditional medicine
(Routledge, 2015)Despite a highly visible presence, policy-maker knowledge of the drivers and participants in the informal economy of wild-harvested medicinal plants in Cape Town remains limited. To illuminate the workings of this local ... -
Implications of the breakdown in the indigenous knowledge system for rangeland management and policy: A case study from the Eastern Cape in South Africa
(Taylor and Francis Group, 2023)Communal rangelands in South Africa are generally perceived as overgrazed owing to complexities in their histories and collective utilisation which often leads to improper management. A suitable ... -
The implications of the reclassification of South African wildlife species as farm animals
(South African Assn. For The Advancement Of Science, 2020)The Government Gazette No. 42464 dated 17 May 20191 amended Table 7 of the Animal Improvement Act (Act no. 62 of 1998), which lists breeds of animals, to include at least 32 new wild animal species, including 24 ...