Browsing Faculty of Natural Sciences by Title
Now showing items 1169-1188 of 2571
-
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
The implementation of a risk based assessment approach by the South African Health pProducts Regulatory Authority (SAHPRA)
(Springer, 2023)An extensive backlog of pending regulatory decisions is one of the major historical challenges that the South African Health Products Regulatory Authority (SAHPRA) inherited from the Medicine Control Council (MCC). Revising ... -
Implementation of groundwater protection measures, particularly resource directed measures in South Africa: a review paper
(Water Policy, 2021)This review paper on groundwater protection measures in South Africa focuses on the actual implementation of groundwater protection measures, in particular, the resource-directed measures (RDM) as described in Chapter 3 ... -
Implementing value chain analysis to investigate drivers and sustainability of Cape Town's informal economy of wild-harvested traditional medicine
(Routledge, 2015)Despite a highly visible presence, policy-maker knowledge of the drivers and participants in the informal economy of wild-harvested medicinal plants in Cape Town remains limited. To illuminate the workings of this local ... -
Implications of the breakdown in the indigenous knowledge system for rangeland management and policy: A case study from the Eastern Cape in South Africa
(Taylor and Francis Group, 2023)Communal rangelands in South Africa are generally perceived as overgrazed owing to complexities in their histories and collective utilisation which often leads to improper management. A suitable ... -
The implications of the reclassification of South African wildlife species as farm animals
(South African Assn. For The Advancement Of Science, 2020)The Government Gazette No. 42464 dated 17 May 20191 amended Table 7 of the Animal Improvement Act (Act no. 62 of 1998), which lists breeds of animals, to include at least 32 new wild animal species, including 24 ... -
Implicit-explicit predictor-corrector methods combined with improved spectral methods for pricing European style vanilla and exotic options
(Kent State University, 2013)In this paper we present a robust numerical method to solve several types of European style option pricing problems. The governing equations are described by variants of Black-Scholes partial differential equations (BS-PDEs) ... -
Importance and relevance of phytochemicals present in Galenia Africana
(Hindawi, 2022)Many people in developing countries rely primarily on medicinal plants as their main source of healthcare, particularly for the treatment of skin infections. Despite the widespread use of medicinal plants, there is a lack ... -
The Importance of Eurekan Mountains on Cenozoic Sediment Routing on the Western Barents She
(MDPI, 2023)The importance of topography generated by Eocene Eurekan deformation as a sediment source for sandstones deposited on the western Barents Shelf margin is evaluated through a sediment provenance study conducted on wellbore ... -
Imprints of temperature fluctuations on the z ∼ 5 Lyman-α forest: a view from radiation-hydrodynamic simulations of reionization
(Oxford academic, 2019)Reionization leads to large spatial fluctuations in the intergalactic temperature that can persist well after its completion. We study the imprints of such fluctuations on the z ∼ 5 Ly α forest flux power spectrum using ... -
Improved bi-functional oxygen electrocatalytic performance of PteIr alloy nanoparticles embedded on MWCNT with Pt-enriched surfaces
(Energy, 2020)Multi-walled carbon nanotube supported PteIr nanoparticles (PteIr/MWCNT) with different elemental ratios were synthesized by one-pot co-reduction approach under ambient conditions. The PteIr catalysts exhibit improved ... -
Improved cellulase expression in diploid yeast strains enhanced consolidated bioprocessing of pretreated corn residues
(ScienceDirect, 2019)In an effort to find a suitable genetic background for efficient cellulolytic secretion, genetically diverse strains were transformed to produce core fungal cellulases namely, β-glucosidase (BGLI), endoglucanase (EGII) and ... -
Improved Hand-Tracking Framework with a Recovery Mechanism
(Telkom, 2013)Abstract−Hand-tracking is fundamental to translating sign language to a spoken language. Accurate and reliable sign language translation depends on effective and accurate hand-tracking. This paper proposes an improved ... -
Improved hydrogenation kinetics of timn1.52 alloy coated with palladium through electroless deposition
(MPDI, 2021)The deterioration of hydrogen charging performances resulting from the surface chemical action of electrophilic gases such as CO2 is one of the prevailing drawbacks of TiMn1.52 materials. In this study, we report the ... -
Improved SAAO–2MASS photometry transformations
(Oxford University Press, 2007)Near-infrared photometry of 599 stars is used to calculate transformations from the South African Astronomical Observatory (SAAO) JHK system to the Two-Micron All-Sky Survey (2MASS) JHKS system. Both several-term formal ... -
Improved upper limits on the 21 cm signal power spectrum of neutral hydrogen at z ≈ 9.1 from LOFAR
(Oxford University Press, 2020)A new upper limit on the 21 cm signal power spectrum at a redshift of z ≈ 9.1 is presented, based on 141 h of data obtained with the Low-Frequency Array (LOFAR). The analysis includes significant improvements in spectrally ... -
Improvement of hydriding kinetics of LaNi5-type metal alloy through substitution of nickel with tin followed by palladium deposition
(Indian Academy of Sciences, 2022)Hydrogen absorption performances of LaNi5 alloy are sensitive to the surface reactions with poisonous gases, such as oxygen, readily forming oxides/hydroxides. In this study, we report the studies on the hydrogen ... -
Improvements in cosmological constraints from breaking growth degeneracy
(EDP Sciences, 2020)The key probes of the growth of a large-scale structure are its rate f and amplitude σ8. Redshift space distortions in the galaxy power spectrum allow us to measure only the combination fσ8, which can be used to constrain ... -
Improving maternal and reproductive health in Ethiopia
(Sage Publications, 2017)This study aimed to examine the relationship between maternal health and good quality of life in an attempt to understand the years between 2005 and 2011. Data from the Ethiopia Demographic and Health Surveys 2005 and 2011 ...