Search
Now showing items 51-60 of 122
Functional metal oxides synthesized using natural extracts from waste maize materials
(Elsevier, 2021)
We show in this article the possibilities of employing an environmentally friendly, uncomplicated, economical
and sustainable green synthesis technique effected by natural extracts from waste maize (zea mays lea) materials
to ...
Acylation of anisole with benzoyl chloride over rapidly synthesized fly ash–based hbea zeolite
(Frontiers Media, 2021)
Stable HBEA zeolite with high surface area and strong acid sites was synthesized from coal
fly ash–based silica extract via indirect hydrothermal synthesis. The rapid HBEA
hydrothermal crystallization times of 8, 10, and ...
Nickel contamination analysis at cost-effective silver printed paper-based electrodes based on carbon black dimethylglyoxime ink as electrode modifier
(International Association of Physical Chemists, 2022)
Electrochemical detection of metal cations at paper-based sensors has been suggested as an attractive alternative to current spectroscopic and chromatographic detection techniques due to the ease of ...
Galaxy and Mass Assembly (GAMA): A WISE Study of the Activity of Emission-line Systems in G23
(2020)
We present a detailed study of emission-line systems in the GAMA G23 region, making use of WISE
photometry that includes carefully measured resolved sources. After applying several cuts to the initial
catalogue of ∼41,000 ...
Effect of pH on the structure and stability of irisin, a multifunctional protein: Multispectroscopic and molecular dynamics simulation approach
(Elsevier, 2021-12)
Irisin is a potential therapeutic agent to prevent or treat various metabolic-related disorders and neurodegenerative diseases viz. Alzheimer’s disease (AD). In this study, we have employed a multispectroscopic
approach ...
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)
The chemistry of the nitrate radical and its contribution to organo-nitrate formation in
the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ...
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)
In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ...
In vitro corrosion of titanium nitride and oxynitride-based biocompatible coatings deposited on stainless steel
(MPDI, 2020)
The reactive cathodic arc deposition technique was used to produce Ti nitride and oxynitride
coatings on 304 stainless steel substrates (SS). Both mono (SS/TiN, SS/TiNO) and bilayer coatings
(SS/TiN/TiNO and SS/TiNO/TiN) ...
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)
Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone
thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...