Search
Now showing items 31-40 of 40
Effect of pH on the structure and stability of irisin, a multifunctional protein: Multispectroscopic and molecular dynamics simulation approach
(Elsevier, 2021-12)
Irisin is a potential therapeutic agent to prevent or treat various metabolic-related disorders and neurodegenerative diseases viz. Alzheimer’s disease (AD). In this study, we have employed a multispectroscopic
approach ...
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)
The chemistry of the nitrate radical and its contribution to organo-nitrate formation in
the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ...
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)
In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)
The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ...
Electrochemiluminescence at 3D Printed Titanium Electrodes
(Frontiers Media SA, 2021)
The fabrication and electrochemical properties of a 3D printed titanium electrode array
are described. The array comprises 25 round cylinders (0.015 cm radius, 0.3 cm high)
that are evenly separated on a 0.48 × 0.48 cm ...
Investigation of biofuel as a potential renewable energy source
(MDPI, 2021)
An accelerating global energy demand, paired with the harmful environmental effects of
fossil fuels, has triggered the search for alternative, renewable energy sources. Biofuels are arguably
a potential renewable energy ...
4-(Dimethylamino)pyridinium chlorosulfonate: A new ionic liquid exhibiting chlorosulfonic acid action as monoprotic Brönsted acid and no sulfonating reagent
(Journal of Molecular Liquids, 2021)
Many papers considered chlorosulfonic acid as a sulfonating and sulfating agent, whereas our previous work and a few reports showed it acts as a monoprotic Brönsted acid. Therefore, in the present work, we decided to respond ...
Fabrication of polyoxometalate-modified palladium–nickel/reduced graphene oxide alloy catalysts for enhanced oxygen reduction reaction activity
(Royal Society of Chemistry, 2021)
Designing advanced nanocatalysts for effectively catalyzing the oxygen reduction reaction (ORR) is of great
importance for practical applications of direct methanol fuel cells (DMFCs). In this work, the reduced
graphene ...
Progress on perovskite materials for energy application
(Elsevier, 2021)
Energy underlies the human development and welfare. Today energy depends on combustion of fossil fuels (coal,
natural gas, oil) sources. These sources have not only led to severe environmental issues because it emits
greenhouse ...