Browsing Faculty of Natural Sciences by Author "Bilibana, Mawethu Pascoe"
Now showing items 1-1 of 1
-
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae (MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ...