Browsing Faculty of Natural Sciences by Author "Feleni, Usisipho"
Now showing items 1-3 of 3
-
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
Sifuba, Sabelo; Willenberg, Shane; Feleni, Usisipho (Hindawi, 2021)In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae (MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Quantum dot-sensitised estrogen receptor-α-based biosensor for 17β-estradiol
Jijana, Abongile N.; Feleni, Usisipho; Ndangili, Peter M.; Bilibana, Mawethu; Ajayi, Rachel F (MDPI, 2023): 17β-estradiol (E2) is an important natural female hormone that is also classified as an estrogenic endocrine-disrupting compound (e-EDC). It is, however, known to cause more damaging health effects compared to other ...