Browsing Chemistry by Title
Now showing items 103-122 of 246
-
Functional metal oxides synthesized using natural extracts from waste maize materials
(Elsevier, 2021)We show in this article the possibilities of employing an environmentally friendly, uncomplicated, economical and sustainable green synthesis technique effected by natural extracts from waste maize (zea mays lea) materials to ... -
Fusion-assisted hydrothermal synthesis and post-synthesis modification of mesoporous hydroxy sodalite zeolite prepared from waste coal fly ash for biodiesel production
(MDPI, 2022)Increases in biodiesel prices remains a challenge, mainly due to the high cost of conventional oil feedstocks used during biodiesel production and the challenges associated with using homogeneous catalysts in the process. ... -
Galaxy and Mass Assembly (GAMA): A WISE Study of the Activity of Emission-line Systems in G23
(2020)We present a detailed study of emission-line systems in the GAMA G23 region, making use of WISE photometry that includes carefully measured resolved sources. After applying several cuts to the initial catalogue of ∼41,000 ... -
Green method synthesised graphene-silver electrochemical nanobiosensors for ethambutol and pyrazinamide
(MDPI, 2020)A novel nanobiosensor was constructed with graphene oxide (GO) sheets coupled to pear extract-based green-synthesised silver nanoparticles (Ag-NPs) to which cytochrome P450-2D6 (CYP2D6) enzyme was attached. The biosensor ... -
Green synthesis of crystalline silica from sugarcane bagasse ash: Physico-chemical properties
(MDPI, 2022)Sugarcane bagasse South Africa is an agricultural waste that poses many environmental and human health problems. Sugarcane bagasse dumps attract many insects that harm the health of the population and cause many diseases. ... -
Green synthesis of silica and silicon from agricultural residue sugarcane bagasse ash – A mini review
(Royal Society of Chemistry, 2023)Silicon dioxide (SiO2), also known as silica, has received attention in recent years due to wide range of capable applications including biomedical/pharmaceutical, energy, food, and personal care products. This has accelerated ... -
The H I intensity mapping bispectrum including observational effects
(2021-07-30)The bispectrum is a three-point statistic with the potential to provide additional information beyond power spectra analyses of survey data sets. Radio telescopes that broadly survey the 21-cm emission from neutral hydrogen ... -
Hall measurements on carbon nanotube paper modified with electroless deposited platinum
(Springer, 2010)Carbon nanotube paper, sometimes referred to as bucky paper, is a random arrangement of carbon nanotubes meshed into a single robust structure, which can be manipulated with relative ease. Multi-walled carbon nanotubes ... -
Helichrysum genus and compound activities in the management of diabetes mellitus
(MDPI, 2022)The global management of diabetes mellitus (DM) involves the administration of recommended anti-diabetic drugs in addition to a non-sedentary lifestyle upon diagnosis. Despite the success recorded from these synthetic ... -
Herbicides in Camps Bay (Cape Town, South Africa), supplemented
(Elsevier, 2021)During 2017 the herbicides alachlor, atrazine, butachlor, metolachlor, and simazine were detected in water samples, beach sediments and marine biota collected at Camps Bay, Cape Town, South Africa. During that period, the ... -
Heterogeneous vanadium Schiff base complexes in catalytic oxidation reactions
(Growing Science, 2023)The chemistry of Schiff base has received remarkable attention in different applications, both organic synthesis and industries. Over the past few years many reports have been on the synthesis, characterization and ... -
Hydrogen storage behavior of magnesium catalyzed by nickel-graphene nanocomposites
(ScienceDirect, 2019)In present study nanocomposites of Graphene Like Material (GLM) and nickel containing 5–60 wt % Ni were prepared by a co-reduction of graphite oxide and Ni2+ ions. These nanocomposites served as effective catalysts of ... -
Hyphenated LC-ICP-MS/ESI-MS identification of halogenated metabolites in South African marine ascidian extracts
(The South African Chemical Institute, 2018)Extracts of 13 species of marine ascidian collected in Algoa Bay were analyzed by LC-ICP-MS/ESI-MS. This technique allows parallel analysis of the molecular species and the presence of certain elements. The LC-ICP-MS/ESI-MS ... -
Identification of new respiratory viruses in the new millennium
(MDPI, 2015)The rapid advancement of molecular tools in the past 15 years has allowed for the retrospective discovery of several new respiratory viruses as well as the characterization of novel emergent strains. The inability to ... -
Imino-phospine palladium (II) and platinum (II) complexes: Synthesis, molecular structures and evaluation as antitumor agents
(Elsevier, 2013)The imino-phosphine ligands L1 and L2 were prepared via condensation reaction of 2-(diphenylphosphino) benzaldehyde with substituted anilines and obtained in very good yields. An equimolar reaction of L1 and L2 with ... -
Imino-quinolyl palladium(II) and platinum(II) complexes: synthesis, characterization, molecular structures and cytotoxic effect
(Elsevier, 2013)Imino-quinolyl ligands L1-L5 were synthesized by condensation reactions and obtained in good yields. Reactions of the ligands with either PdCl2(cod) or K2[PtCl4] gave the corresponding palladium(II) and platinum(II) complexes ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Improved bi-functional oxygen electrocatalytic performance of PteIr alloy nanoparticles embedded on MWCNT with Pt-enriched surfaces
(Energy, 2020)Multi-walled carbon nanotube supported PteIr nanoparticles (PteIr/MWCNT) with different elemental ratios were synthesized by one-pot co-reduction approach under ambient conditions. The PteIr catalysts exhibit improved ... -
In Silico and In Vitro Screening of 50 Curcumin Compounds as EGFR and NF-κB Inhibitors
(MDPI, 2022)The improvement of cancer chemotherapy remains a major challenge, and thus new drugs are urgently required to develop new treatment regimes. Curcumin, a polyphenolic antioxidant derived from the rhizome of turmeric ...