Search
Now showing items 1-2 of 2
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Silver–zinc oxide nanocomposite antiseptic from the extract of Bidens pilosa
(Springer, 2019)
Silver nanoparticles (Ag-NPs), zinc oxide (ZnO-NPs) and zinc oxide–silver (ZnO–Ag-NPs) were biosynthesized based on
the rich matrix of alkaloids, flavones, tannins capping/stabilizing agents present in Bidens pilosa ...