Chemistry
Browse by
Sub-communities within this community
Collections in this community
Recent Submissions
-
Electrochemiluminescence at 3D Printed Titanium Electrodes
(Frontiers Media SA, 2021)The fabrication and electrochemical properties of a 3D printed titanium electrode array are described. The array comprises 25 round cylinders (0.015 cm radius, 0.3 cm high) that are evenly separated on a 0.48 × 0.48 cm ... -
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
In vitro corrosion of titanium nitride and oxynitride-based biocompatible coatings deposited on stainless steel
(MPDI, 2020)The reactive cathodic arc deposition technique was used to produce Ti nitride and oxynitride coatings on 304 stainless steel substrates (SS). Both mono (SS/TiN, SS/TiNO) and bilayer coatings (SS/TiN/TiNO and SS/TiNO/TiN) ... -
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ... -
Design, synthesis and biological evaluation of edaravone derivatives bearing the N-benzyl pyridinium moiety as multifunctional anti-Alzheimer’s agents
(Taylor & Francis, 2020)A series of multi-target directed edaravone derivatives bearing N-benzyl pyridinium moieties were designed and synthesised. Edaravone is a potent antioxidant with significant neuroprotective effects and N-benzyl pyridinium ... -
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)The chemistry of the nitrate radical and its contribution to organo-nitrate formation in the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ... -
Nickel contamination analysis at cost-effective silver printed paper-based electrodes based on carbon black dimethylglyoxime ink as electrode modifier
(International Association of Physical Chemists, 2022)Electrochemical detection of metal cations at paper-based sensors has been suggested as an attractive alternative to current spectroscopic and chromatographic detection techniques due to the ease of ... -
Effect of pH on the structure and stability of irisin, a multifunctional protein: Multispectroscopic and molecular dynamics simulation approach
(Elsevier, 2021-12)Irisin is a potential therapeutic agent to prevent or treat various metabolic-related disorders and neurodegenerative diseases viz. Alzheimer’s disease (AD). In this study, we have employed a multispectroscopic approach ... -
Organic nanostructured materials for sustainable application in next generation solar cells
(MPDI, 2021)Meeting our current energy demands requires a reliable and efficient renewable energy source that will bring balance between power generation and energy consumption. Organic photovoltaic cells (OPVs), perovskite solar ... -
The low-redshift circumgalactic medium in SIMBA
(Oxford University Press, 2021-08)We examine the properties of the low-redshift circumgalactic medium (CGM) around star-forming and quenched galaxies in the SIMBA cosmological hydrodynamic simulations, focusing on comparing H I and metal line absorption ... -
Functional metal oxides synthesized using natural extracts from waste maize materials
(Elsevier, 2021)We show in this article the possibilities of employing an environmentally friendly, uncomplicated, economical and sustainable green synthesis technique effected by natural extracts from waste maize (zea mays lea) materials to ... -
Covid-19 and cancer therapy: Interrelationships and management of cancer cases in the era of Covid-19
(Hindawi, 2021)'e COVID-19 global epidemic poses this generation’s biggest worldwide public health challenge probably since the 1918 influenza epidemic. Recent reports on two new variants have triggered a dramatic upsurge in research ... -
Recent advances in the detection of interferon‑gamma as a TB biomarker
(Springer, 2021)Tuberculosis (TB) is one of the main infectious diseases worldwide and accounts for many deaths. It is caused by Mycobacterium tuberculosis usually afecting the lungs of patients. Early diagnosis and treatment are essential ... -
Acylation of anisole with benzoyl chloride over rapidly synthesized fly ash–based hbea zeolite
(Frontiers Media, 2021)Stable HBEA zeolite with high surface area and strong acid sites was synthesized from coal fly ash–based silica extract via indirect hydrothermal synthesis. The rapid HBEA hydrothermal crystallization times of 8, 10, and ... -
Advances in nanotechnology towards development of silver nanoparticle-based wound-healing agents
(MPDI, 2021)Since antiquity, silver-based therapies have been used in wound healing, wound care and management of infections to provide adequate healing. These therapies are associated with certain limitations, such as toxicity, ... -
Crystal structure of 2,2′-(propane- 1,3-dilylbis(azaneylylidene))bis(methanylylidene) bis(4-methylphenol), C19H22N2O2
(De Gruyter, 2021)C19H22N2O2, monoclinic, P21/c (no. 14), a = 19.3063(4) Å, b = 5.83200(10) Å, c = 14.7996(3) Å, β = 92.715(1)°, V = 1664.48(6) Å3, Z= 4, Rgt(F) = 0.0423, wRref (F2) = 0.1102, T = 100(2) K. -
1D NiHPO4 nanotubes prepared using dissolution equilibrium as bifunctional electrocatalyst for high-efficiency water splitting
(Journal of Power Sources, 2021)In this work, one-dimensional NiHPO4 nanotubes are successfully fabricated on nickel foam by hydrothermal reaction, in which a dissolution equilibrium between phosphates is controlled by tuning the proportion of the mixed ... -
The H I intensity mapping bispectrum including observational effects
(2021-07-30)The bispectrum is a three-point statistic with the potential to provide additional information beyond power spectra analyses of survey data sets. Radio telescopes that broadly survey the 21-cm emission from neutral hydrogen ...