Browsing Faculty of Natural Sciences by Title
Now showing items 1151-1170 of 2571
-
The impact of male overweight on semen quality and outcome of assisted reproduction
(Medknow Publications, 2014)The impact of obesity on male reproductive health remains a contested topic as evidence is inconclusive and inconsistent. Even more debatable is the effect of male obesity in assisted reproduction. In the manuscript, ... -
Impact of metagenomic DNA extraction procedures on the identifiable endophytic bacterial diversity in Sorghum bicolor (L. Moench)
(Elsevier, 2015)Culture-independent studies rely on the quantity and quality of the extracted environmental metagenomic DNA (mDNA). To fully access the plant tissue microbiome, the extracted plant mDNA should allow optimal PCR applications ... -
The Impact of Observing Strategy on Cosmological Constraints with LSST
(2022)The generation-defining Vera C. Rubin Observatory will make state-of-the-art measurements of both the static and transient universe through its Legacy Survey for Space and Time (LSST). With such capabilities, it is immensely ... -
The impact of quenching on galaxy profiles in the SIMBA simulation
(Oxford University Press, 2020)We study specific star formation rate (sSFR) and gas profiles of star-forming (SF) and green valley (GV) galaxies in the SIMBA cosmological hydrodynamic simulation. SF galaxy half-light radii (Rhalf) at z = 0 and their ... -
Impact of Rubin observatory cadence choices on supernovae photometric classification
(American Astronomical Society, 2023)The Vera C. Rubin Observatory’s Legacy Survey of Space and Time (LSST) will discover an unprecedented number of supernovae (SNe), making spectroscopic classification for all the events infeasible. LSST will thus rely on ... -
Impact of Rubin Observatory Cadence Choices on Supernovae Photometric Classification
(The Astrophysical Journal Supplement Series, 2023)The Vera C. Rubin Observatory’s Legacy Survey of Space and Time (LSST) will discover an unprecedented number of supernovae (SNe), making spectroscopic classification for all the events infeasible. LSST will thus rely on ... -
The impact of solar wind variability on pulsar timing
(EDP Sciences, 2021)Context. High-precision pulsar timing requires accurate corrections for dispersive delays of radio waves, parametrized by the dispersion measure (DM), particularly if these delays are variable in time. In a previous paper, ... -
The impact of sperm DNA damage in assisted conception and beyond: recent advances in diagnosis and treatment
(Elsevier, 2013)Sperm DNA damage is a useful biomarker for male infertility diagnosis and prediction of assisted reproduction outcomes. It is associated with reduced fertilization rates, embryo quality and pregnancy rates, and higher ... -
The Impact of Storage Time and Seasonal Harvesting on Levels of Sutherlandins and Sutherlandiosides in Lessertia frutescens
(Conference: Faculty of Community and Health Sciences 2nd Research Day, 2013)In South Africa, an estimate of 70% of the population frequently uses traditional medicine for their health care needs. The use of Lessertia frutescens (Figure 1,2) by various cultural groups dates back to the earlier ... -
The impact of the connectivity of the cosmic web on the physical properties of galaxies at its nodes
(Oxford University Press, 2019)We investigate the impact of the number of filaments connected to the nodes of the cosmic web on the physical properties of their galaxies using the Sloan Digital Sky Survey. We compare these measurements to the cosmological ... -
Impact of Varicocele Repair on Semen Parameters in Infertile Men: A Systematic Review and Meta-Analysis
(Korean Society for Sexual Medicine and Andrology, 2023)Purpose: Despite the significant role of varicocele in the pathogenesis of male infertility, the impact of varicocele repair (VR) on conventional semen parameters remains controversial. Only a few systematic reviews and ... -
The impact of wind scalings on stellar growth and the baryon cycle in cosmological simulations
(Oxford University Press, 2020)Many phenomenologically successful cosmological simulations employ kinetic winds to model galactic outflows. Yet systematic studies of how variations in kinetic wind scalings might alter observable galaxy properties are ... -
Impacts of an invasive alien Proteaceae on native plant species richness and vegetation structure
(South African Journal of Botany, 2021)The influence of invasive alien plants on plant community structure and above ground biomass in their novel range is poorly understood, as the magnitude and direction of these effects are often species and ecosystem specific. ... -
Impacts of climate variability and drought on surface water resources in sub-saharan africa using remote sensing: A review
(Remote Sensing, 2022)Climate variability and recurrent droughts have caused remarkable strain on water resources in most regions across the globe, with the arid and semi-arid areas being the hardest hit. The impacts have been notable on surface ... -
Impacts of eco-environmental quality, spatial configuration, and landscape connectivity of urban vegetation patterns on seasonal land surface temperature in Harare metropolitan city, Zimbabwe
(Taylor and Francis Group, 2022)The study examined the impact of eco-environmental quality conditions, spatial configurations and landscape connectivity of urban vegetation on seasonal land surface temperature (LST) in Harare, Zimbabwe between May and ... -
Impacts of groundwater and climate variability on terrestrial groundwater dependent ecosystems: A review of geospatial assessment approaches and challenges and possible future research directions
(Taylor and Francis Group, 2022)Terrestrial groundwater dependent vegetation (TGDV) are crucialecosystems which provide important goods and services such ascarbon sequestration, habitat, water purification and aestheticbenefits in semi-arid environments. ... -
Impacts of plastic debris on biota and implications for human health: A South African perspective
(South African Assn. For The Advancement Of Science, 2020)Entanglement and ingestion of plastics are the main ecological impacts of marine plastic debris on marine biota, but indirect effects such as the transport of alien species and benthic smothering are also important to note. ... -
Impacts of the spatial configuration of built-up areas and urban vegetation on land surface temperature using spectral and local spatial autocorrelation indices
(Remote Sensing Letters, 2022)Understanding how the spatial configuration of land cover patterns of built-up areas and urban vegetation affect urban surface temperatures is crucial for improving the sustainability of cities as well as optimizing urban ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ...