Faculty of Natural Sciences: Recent submissions
Now showing items 901-920 of 2639
-
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ... -
Cleaning foregrounds from single-dish 21 cm intensity maps with Kernel principal component analysis
(Oxford University Press, 2021)he high dynamic range between contaminating foreground emission and the fluctuating 21 cm brightness temperature field is one of the most problematic characteristics of 21 cm intensity mapping data. While these components ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Quantification and characterisation of microplastics ingested by selected juvenile fish species associated with mangroves in KwaZulu- Natal, South Africa
(Elsevier, 2020)Though the number studies on microplastic ingestion by fish is growing, data on fish species charac- teristic of the South African coastline are scarce. This study quantified and characterised (physically and chemically) ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Biological synthesis of gold and silver nanoparticles using leaf extracts of Crassocephalum rubens and their comparative in vitro antioxidant activities
(Elsevier, 2020)The use of plant and plant products in the synthesis of silver nanoparticles (AgNPs) and gold nanoparticles (AuNPs) is made possible because of the natural inherent phytochemicals responsible for the reduction of respective ... -
Phenolic content, antioxidant, cytotoxic and antiproliferative effects of fractions of Vigna subterraenea (L.) verdc from Mpumalanga, South Africa
(Elsevier, 2021)Consistent intake of legumes has been correlated with decreased possibility of developing colorectal cancer (CRC) due to the content of some phytochemicals like polyphenols. Bambara groundnut (BGN) is an underutilized ... -
Effect of landscape pattern and spatial configuration of vegetation patches on urban warming and cooling in Harare metropolitan city, Zimbabwe
(Bellweather Publishing, 2021)The spatial configuration of vegetation patches in the landscape has implications for the provision of ecosystem services, human adaptation to climate change, enhancement, or mitigation of urban heat island. Until recently, ... -
A cursory look at the fishmeal/oil industry from an ecosystem perspective
(Frontiers Media, 2021)By supporting the fishmeal industry, are we competing with marine predators? Should we be taking away food from marine predators to subsidize agriculture? If not for human consumption, should forage fish be left in the ... -
Antimicrobial resistance screening and profiles: A glimpse from the South African perspective
(IWA Publishing, 2020)According to the Centre for Disease Dynamics Economics and Policy, South Africa represents a paradox of antibiotic management similar to other developing countries, with both overuse and underuse (resulting from lack of ... -
Improved hydrogenation kinetics of timn1.52 alloy coated with palladium through electroless deposition
(MPDI, 2021)The deterioration of hydrogen charging performances resulting from the surface chemical action of electrophilic gases such as CO2 is one of the prevailing drawbacks of TiMn1.52 materials. In this study, we report the ... -
Influence of multiple uses of water on the sustainability of communally-managed rural water supply systems in Zimbabwe
(IWA Publishing, 2021)The utilisation of drinking water supply systems for productive uses is not a new practice in Zimbabwe and the world over. This study sought to explore how multiple uses of water, in this case community gardening as a ... -
Inhibitory potential of repurposed drugs against the SARS-CoV-2 main protease: A computational-aided approach
(Taylor and Francis, 2020)The exponential increase in cases and mortality of coronavirus disease (COVID-19) has called for a need to develop drugs to treat this infection. Using in silico and molecular docking approaches, this study investigated ... -
In vitro corrosion of titanium nitride and oxynitride-based biocompatible coatings deposited on stainless steel
(MPDI, 2020)The reactive cathodic arc deposition technique was used to produce Ti nitride and oxynitride coatings on 304 stainless steel substrates (SS). Both mono (SS/TiN, SS/TiNO) and bilayer coatings (SS/TiN/TiNO and SS/TiNO/TiN) ... -
Continuous professional development for public sector pharmacists in South Africa: A case study of mapping competencies in a pharmacists’ preceptor programme
(MPDI, 2020)Lifelong learning among healthcare practitioners is crucial to keep abreast of advances in therapeutic and service delivery approaches. In South Africa, continuous professional development (CPD) was mandated (2019) for ... -
Nutritional quality of Calobota sericea fodders. A preliminary assessment
(Taylor and Francis, 2021)This study aimed to provide preliminary information regarding the nutritional quality of Calobota sericea, a preferred perennial legume forage species from the water-limited rangelands of South Africa. Calobota sericea ... -
Differential sensitivity of two endothelial cell lines to hydrogen peroxide toxicity: Relevance for in vitro studies of the blood–brain barrier
(MPDI, 2020)Oxidative stress (OS) has been linked to blood–brain barrier (BBB) dysfunction which in turn has been implicated in the initiation and propagation of some neurological diseases. In this study, we profiled, for the first ... -
The use of Radon (Rn222) isotopes to detect groundwater discharge in streams draining Table Mountain Group (TMG) aquifers
(Water Research Commission (WRC), 2021)Environmental isotopes have been used for decades as natural tracers in studies aimed at understanding complex hydrogeological processes such as groundwater and surface water interactions. Radon (Rn222) is a naturally ... -
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ... -
Pharmacists’ approach to optimise safe medication use in paediatric patients
(MPDI, 2021)Paediatric patients are unique, yet challenging patients to care for by pharmacists. Paediatric medicine use requires special consideration. Pharmacists play an important role in educating and counselling patients, carers, ...