Search
Now showing items 1-10 of 62
Beef-derived mesoporous carbon as highly efficient support for PtRuIr electrocatalysts and their high activity for CO and methanol oxidation
(SACI, 2014)
In this work, a low-cost and nitrogen-containing carbon with mesoporous pores and high surface area was synthesized by
carbonizing a natural biomass precursor, i.e. beef. It is found that the prepared material has excellent ...
Scaling factors for channel width variations in treelike flow field patterns for polymer electrolyte membrane fuel cells - An experimental study
(Elsevier, 2021)
To have a uniform distribution of reactants is an advantage to a fuel cell. We report results
for such a distributor with tree-like flow field plates (FFP). Numerical simulations have
shown that the width scaling parameters ...
Crystal structure of saposin B reveals a dimeric shell for lipid binding
(National Academy of Sciences, 2003)
Saposin B is a small, nonenzymatic glycosphingolipid activator
protein required for the breakdown of cerebroside sulfates (sulfatides) within the lysosome. The protein can extract target lipids
from membranes, forming ...
1D NiHPO4 nanotubes prepared using dissolution equilibrium as bifunctional electrocatalyst for high-efficiency water splitting
(Journal of Power Sources, 2021)
In this work, one-dimensional NiHPO4 nanotubes are successfully fabricated on nickel foam by hydrothermal reaction, in which a dissolution equilibrium between phosphates is controlled by tuning the proportion of the mixed ...
The synthesis of 7,9-dimethoxy-3-propyl-3,4-dihydro-1H-benzo[g]isochromene1,5,10-trione: A potential monomer for the synthesis of the natural product xylindein
(Arkivoc, 2020)
A novel synthesis of a 3-propyl-substituted-benzo[g]isochromene quinone, a potential monomer of the
natural product xylindein, was accomplished in 9 steps (overall yield of 8.2%) from 2,4-
dimethoxybenzaldehyde. Key steps ...
Acylation of anisole with benzoyl chloride over rapidly synthesized fly ash–based hbea zeolite
(Frontiers Media, 2021)
Stable HBEA zeolite with high surface area and strong acid sites was synthesized from coal
fly ash–based silica extract via indirect hydrothermal synthesis. The rapid HBEA
hydrothermal crystallization times of 8, 10, and ...
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)
The chemistry of the nitrate radical and its contribution to organo-nitrate formation in
the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ...
Improved hydrogenation kinetics of timn1.52 alloy coated with palladium through electroless deposition
(MPDI, 2021)
The deterioration of hydrogen charging performances resulting from the surface chemical
action of electrophilic gases such as CO2
is one of the prevailing drawbacks of TiMn1.52 materials.
In this study, we report the ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Spectroscopy, morphology, and electrochemistry of electrospun polyamic acid nanofibers
(Frontiers Media, 2022)
Polyamic acid (PAA) nanofibers produced by using the electrospinning method were fully
characterized in terms of morphology and spectroscopy. A PAA nanofiber–modified
screen-printed carbon electrode was applied to the ...