Browsing Chemistry by Title
Now showing items 109-128 of 246
-
The H I intensity mapping bispectrum including observational effects
(2021-07-30)The bispectrum is a three-point statistic with the potential to provide additional information beyond power spectra analyses of survey data sets. Radio telescopes that broadly survey the 21-cm emission from neutral hydrogen ... -
Hall measurements on carbon nanotube paper modified with electroless deposited platinum
(Springer, 2010)Carbon nanotube paper, sometimes referred to as bucky paper, is a random arrangement of carbon nanotubes meshed into a single robust structure, which can be manipulated with relative ease. Multi-walled carbon nanotubes ... -
Helichrysum genus and compound activities in the management of diabetes mellitus
(MDPI, 2022)The global management of diabetes mellitus (DM) involves the administration of recommended anti-diabetic drugs in addition to a non-sedentary lifestyle upon diagnosis. Despite the success recorded from these synthetic ... -
Herbicides in Camps Bay (Cape Town, South Africa), supplemented
(Elsevier, 2021)During 2017 the herbicides alachlor, atrazine, butachlor, metolachlor, and simazine were detected in water samples, beach sediments and marine biota collected at Camps Bay, Cape Town, South Africa. During that period, the ... -
Heterogeneous vanadium Schiff base complexes in catalytic oxidation reactions
(Growing Science, 2023)The chemistry of Schiff base has received remarkable attention in different applications, both organic synthesis and industries. Over the past few years many reports have been on the synthesis, characterization and ... -
Hydrogen storage behavior of magnesium catalyzed by nickel-graphene nanocomposites
(ScienceDirect, 2019)In present study nanocomposites of Graphene Like Material (GLM) and nickel containing 5–60 wt % Ni were prepared by a co-reduction of graphite oxide and Ni2+ ions. These nanocomposites served as effective catalysts of ... -
Hyphenated LC-ICP-MS/ESI-MS identification of halogenated metabolites in South African marine ascidian extracts
(The South African Chemical Institute, 2018)Extracts of 13 species of marine ascidian collected in Algoa Bay were analyzed by LC-ICP-MS/ESI-MS. This technique allows parallel analysis of the molecular species and the presence of certain elements. The LC-ICP-MS/ESI-MS ... -
Identification of new respiratory viruses in the new millennium
(MDPI, 2015)The rapid advancement of molecular tools in the past 15 years has allowed for the retrospective discovery of several new respiratory viruses as well as the characterization of novel emergent strains. The inability to ... -
Imino-phospine palladium (II) and platinum (II) complexes: Synthesis, molecular structures and evaluation as antitumor agents
(Elsevier, 2013)The imino-phosphine ligands L1 and L2 were prepared via condensation reaction of 2-(diphenylphosphino) benzaldehyde with substituted anilines and obtained in very good yields. An equimolar reaction of L1 and L2 with ... -
Imino-quinolyl palladium(II) and platinum(II) complexes: synthesis, characterization, molecular structures and cytotoxic effect
(Elsevier, 2013)Imino-quinolyl ligands L1-L5 were synthesized by condensation reactions and obtained in good yields. Reactions of the ligands with either PdCl2(cod) or K2[PtCl4] gave the corresponding palladium(II) and platinum(II) complexes ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Improved bi-functional oxygen electrocatalytic performance of PteIr alloy nanoparticles embedded on MWCNT with Pt-enriched surfaces
(Energy, 2020)Multi-walled carbon nanotube supported PteIr nanoparticles (PteIr/MWCNT) with different elemental ratios were synthesized by one-pot co-reduction approach under ambient conditions. The PteIr catalysts exhibit improved ... -
In Silico and In Vitro Screening of 50 Curcumin Compounds as EGFR and NF-κB Inhibitors
(MDPI, 2022)The improvement of cancer chemotherapy remains a major challenge, and thus new drugs are urgently required to develop new treatment regimes. Curcumin, a polyphenolic antioxidant derived from the rhizome of turmeric ... -
In vitro corrosion of titanium nitride and oxynitride-based biocompatible coatings deposited on stainless steel
(MPDI, 2020)The reactive cathodic arc deposition technique was used to produce Ti nitride and oxynitride coatings on 304 stainless steel substrates (SS). Both mono (SS/TiN, SS/TiNO) and bilayer coatings (SS/TiN/TiNO and SS/TiNO/TiN) ... -
In-situ ultrasonic monitoring of zeolite A crystallization from coal fly ash
(Elsevier, 2012)In this study, high phase purity of zeolite A was prepared from coal fly ash precursors. The molar regime of both the clear solution extract and unseparated fly ash slurry was adjusted to achieve the right composition for ... -
Influence of quantum dot surface on electrochemical DNA sensing mechanism
(Wiley, 2020)Owing to their high surface‐to‐volume ratio, electrocatalytic activity, biocompatibility and novel electron transport properties, quantum dots (QDs) are highly attractive materials for the ultrasensitive detection of ... -
Inhibition of HIV-1 enzymes, antioxidant and anti-inflammatory activities of Plectranthus barbatus
(Elsevier, 213)Ethnopharmacological relevance: Plectranthus barbatus is widely used in African countries as an herbal remedy to manage HIV/AIDS and related conditions. Aim of the study: To investigate the HIV-1 inhibitory, anti-inflammatory ... -
Inhibition of oxidative stress and skin aging-related enzymes by prenylated chalcones and other flavonoids from helichrysum teretifolium
(MDPI, 2015)Ten flavonoid-related structures viz. heliteretifolin (1), isoxanthohumol (2), 2',4',6'-trihydroxy-3'-prenylchalcone (3), isoglabranin (4), glabranin (5), 7-methoxyisoglabranin (6), quercetin (7), 4'-methoxyquercetin ... -
Instrumental techniques for characterization of molybdenum disulphide nanostructures
(Hindawi, 2020)The excellent chemical and physical properties of materials (nanomaterials) with dimensions of less than 100 nm (nanometers) resulted in researchers and industrialists to have great interest in their discovery and applications ...