Search
Now showing items 31-40 of 45
Covid-19 and cancer therapy: Interrelationships and management of cancer cases in the era of Covid-19
(Hindawi, 2021)
'e COVID-19 global epidemic poses this generation’s biggest worldwide public health challenge probably since the 1918
influenza epidemic. Recent reports on two new variants have triggered a dramatic upsurge in research ...
Functional metal oxides synthesized using natural extracts from waste maize materials
(Elsevier, 2021)
We show in this article the possibilities of employing an environmentally friendly, uncomplicated, economical
and sustainable green synthesis technique effected by natural extracts from waste maize (zea mays lea) materials
to ...
Acylation of anisole with benzoyl chloride over rapidly synthesized fly ash–based hbea zeolite
(Frontiers Media, 2021)
Stable HBEA zeolite with high surface area and strong acid sites was synthesized from coal
fly ash–based silica extract via indirect hydrothermal synthesis. The rapid HBEA
hydrothermal crystallization times of 8, 10, and ...
Effect of pH on the structure and stability of irisin, a multifunctional protein: Multispectroscopic and molecular dynamics simulation approach
(Elsevier, 2021-12)
Irisin is a potential therapeutic agent to prevent or treat various metabolic-related disorders and neurodegenerative diseases viz. Alzheimer’s disease (AD). In this study, we have employed a multispectroscopic
approach ...
Organic nanostructured materials for sustainable application in next generation solar cells
(MPDI, 2021)
Meeting our current energy demands requires a reliable and efficient renewable energy
source that will bring balance between power generation and energy consumption. Organic photovoltaic cells (OPVs), perovskite solar ...
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)
The chemistry of the nitrate radical and its contribution to organo-nitrate formation in
the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ...
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)
In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)
The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ...
Electrochemiluminescence at 3D Printed Titanium Electrodes
(Frontiers Media SA, 2021)
The fabrication and electrochemical properties of a 3D printed titanium electrode array
are described. The array comprises 25 round cylinders (0.015 cm radius, 0.3 cm high)
that are evenly separated on a 0.48 × 0.48 cm ...