Search
Now showing items 1-6 of 6
Green method synthesised graphene-silver electrochemical nanobiosensors for ethambutol and pyrazinamide
(MDPI, 2020)
A novel nanobiosensor was constructed with graphene oxide (GO) sheets coupled to
pear extract-based green-synthesised silver nanoparticles (Ag-NPs) to which cytochrome P450-2D6
(CYP2D6) enzyme was attached. The biosensor ...
Dry Gongronema latifolium aqueous extract mediated silver nanoparticles by one-step in-situ biosynthesis for antibacterial activities
(Elsevier, 2021)
In-situ biosynthesis of silver nanoparticles for antibacterial activities doped with aqueous extract of dry Gongronema Latifolium (DGL) is presented in this work. The absorbance was determined using a UV-Visible analysis ...
Fabrication of silver‑coated PET track‑etched membrane as SERS platform for detection of acetaminophen
(Springer, 2021-09)
In this study, silver nanoparticles (AgNPs) were immobilized on the surface of polyethylene terephthalate (PET) membrane
using diethylenetriamine (DETA) as a chemical linker. The molecule of DETA was attached to the surface ...
Advances in nanotechnology towards development of silver nanoparticle-based wound-healing agents
(MPDI, 2021)
Since antiquity, silver-based therapies have been used in wound healing, wound care and
management of infections to provide adequate healing. These therapies are associated with certain
limitations, such as toxicity, ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Silver–zinc oxide nanocomposite antiseptic from the extract of Bidens pilosa
(Springer, 2019)
Silver nanoparticles (Ag-NPs), zinc oxide (ZnO-NPs) and zinc oxide–silver (ZnO–Ag-NPs) were biosynthesized based on
the rich matrix of alkaloids, flavones, tannins capping/stabilizing agents present in Bidens pilosa ...