Research Articles (Chemistry)
Browse by
Recent Submissions
-
Anode materials for lithium-ion batteries: A review
(Elsevier, 2022)The need for eco-friendly and portable energy sources for application in electrical, electronic, automobile and even aerospace industries has led to an ever-increasing research and innovation in lithium-ion battery technology. ... -
Investigation of biofuel as a potential renewable energy source
(MDPI, 2021)An accelerating global energy demand, paired with the harmful environmental effects of fossil fuels, has triggered the search for alternative, renewable energy sources. Biofuels are arguably a potential renewable energy ... -
In Silico and In Vitro Screening of 50 Curcumin Compounds as EGFR and NF-κB Inhibitors
(MDPI, 2022)The improvement of cancer chemotherapy remains a major challenge, and thus new drugs are urgently required to develop new treatment regimes. Curcumin, a polyphenolic antioxidant derived from the rhizome of turmeric ... -
Electrodeposited CuO thin film for wide linear range photoelectrochemical glucose sensing
(Elsevier, 2022)Cupric oxide (CuO) has been used as a non-enzymatic glucose sensor for decades. However, there is a paucity of publications on bare CuO based photo electrochemical (PEC) glucose detection. In this study, a photo active ... -
Synthesis and reactivities of conducting hexathienylbenzene-co-poly(3-hexylthiophene) star-branched copolymer as donor material for organic photovoltaic cell
(Frontiers Media, 2022)The hexathienylbenzene-co-poly(3-hexylthiophene-2,5diyl) (HTB-co-P3HT) conducting polymer was synthesized by oxidative co-polymerization of hexathienylbenzene (HTB) and 3-hexylthiophene using iron chloride (FeCl3) as an ... -
Microwave-assisted synthesis of schiff base metal–ligand complexes with copper and nickel centres for electrochemical in vitro sensing of nitric oxide in an aqueous solution
(MDPI, 2022)Nitric oxide (NO), the smallest signalling molecule known in the human body, keeps blood vessels dilated, controls blood pressure, and has numerous other health regulatory effects. The use of Schiff base complexes ... -
Spectroscopy, morphology, and electrochemistry of electrospun polyamic acid nanofibers
(Frontiers Media, 2022)Polyamic acid (PAA) nanofibers produced by using the electrospinning method were fully characterized in terms of morphology and spectroscopy. A PAA nanofiber–modified screen-printed carbon electrode was applied to the ... -
Aerosol mass and size‑resolved metal content in urban Bangkok, Thailand
(Springer, 2022)Inhalable particulate matter (PM) is a health concern, and people living in large cities such as Bangkok are exposed to high concentrations. This exposure has been linked to respiratory and cardiac diseases and cancers ... -
Alpha-glucosidase and alpha-amylase inhibitory activities, molecular docking, and antioxidant capacities of plectranthus ecklonii constituents
(MDPI, 2022)Shortage in insulin secretion or degradation of produced insulin is the principal characteristic of the metabolic disorder of diabetes mellitus (DM). However, because the current medications for the treatment of DM have ... -
Characterization of four new compounds from protea cynaroides leaves and their tyrosinase inhibitory potential
(MDPI, 2022)Protea cynaroides (king protea) is a flowering plant that belongs to the Proteaceae family. This multi-stemmed shrub is the national flower of South Africa and has important economic and medicinal values. Traditionally, ... -
Electrochemiluminescence at 3D Printed Titanium Electrodes
(Frontiers Media SA, 2021)The fabrication and electrochemical properties of a 3D printed titanium electrode array are described. The array comprises 25 round cylinders (0.015 cm radius, 0.3 cm high) that are evenly separated on a 0.48 × 0.48 cm ... -
Correction: Layer-structured FeCo bihydroxide as an ultra-stable bifunctional electrocatalyst for water splitting at high current densities
(Royal society of chemistry, 2021)The development of stable bifunctional electrodes capable of operation at high current densities is a key requirement for large scale hydrogen generation by water electrolysis. Herein, amorphous FeCo hydroxides are ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Impedimetric and electrochemical evaluation of a new redox active steroid derivative for hormone immunosensing
(Elsevier, 2020)Preparation and electrochemical interrogation of a novel redox active progesterone derivative progesterone thiosemicarbazone (PATC) is presented here together with an investigation into its suitability as conjugate ... -
In vitro corrosion of titanium nitride and oxynitride-based biocompatible coatings deposited on stainless steel
(MPDI, 2020)The reactive cathodic arc deposition technique was used to produce Ti nitride and oxynitride coatings on 304 stainless steel substrates (SS). Both mono (SS/TiN, SS/TiNO) and bilayer coatings (SS/TiN/TiNO and SS/TiNO/TiN) ... -
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
(Hindawi, 2021)In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ... -
Design, synthesis and biological evaluation of edaravone derivatives bearing the N-benzyl pyridinium moiety as multifunctional anti-Alzheimer’s agents
(Taylor & Francis, 2020)A series of multi-target directed edaravone derivatives bearing N-benzyl pyridinium moieties were designed and synthesised. Edaravone is a potent antioxidant with significant neuroprotective effects and N-benzyl pyridinium ... -
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)The chemistry of the nitrate radical and its contribution to organo-nitrate formation in the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ... -
Nickel contamination analysis at cost-effective silver printed paper-based electrodes based on carbon black dimethylglyoxime ink as electrode modifier
(International Association of Physical Chemists, 2022)Electrochemical detection of metal cations at paper-based sensors has been suggested as an attractive alternative to current spectroscopic and chromatographic detection techniques due to the ease of ... -
Effect of pH on the structure and stability of irisin, a multifunctional protein: Multispectroscopic and molecular dynamics simulation approach
(Elsevier, 2021-12)Irisin is a potential therapeutic agent to prevent or treat various metabolic-related disorders and neurodegenerative diseases viz. Alzheimer’s disease (AD). In this study, we have employed a multispectroscopic approach ...