Browsing Research Articles (Chemistry) by Author "Feleni, Usisipho"
Now showing items 1-2 of 2
-
Electrochemical analysis of architecturally enhanced LiFe0.5Mn0.5PO4 multiwalled carbon nanotube composite
Sifuba, Sabelo; Willenberg, Shane; Feleni, Usisipho (Hindawi, 2021)In this work, the effect of carbon on the electrochemical properties of multiwalled carbon nanotube (MWCNT) functionalized lithium iron manganese phosphate was studied. In an attempt to provide insight into the structural ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
Bilibana, Mawethu Pascoe; Feleni, Usisipho; Williams, Avril Rae (MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ...