Browsing Research Articles (Chemistry) by Subject "Chemistry"
Now showing items 21-40 of 45
-
Heterogeneous vanadium Schiff base complexes in catalytic oxidation reactions
(Growing Science, 2023)The chemistry of Schiff base has received remarkable attention in different applications, both organic synthesis and industries. Over the past few years many reports have been on the synthesis, characterization and ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Inhibition of HIV-1 enzymes, antioxidant and anti-inflammatory activities of Plectranthus barbatus
(Elsevier, 213)Ethnopharmacological relevance: Plectranthus barbatus is widely used in African countries as an herbal remedy to manage HIV/AIDS and related conditions. Aim of the study: To investigate the HIV-1 inhibitory, anti-inflammatory ... -
Materials, components, assembly and performance of flexible polymer electrolyte membrane fuel cell: A review
(Elsevier, 2023)With emerging demand of potable and wearable electronic devices, reliable and flexible energy suppliers are inevitable. Polymer electrolyte membrane fuel cells (PEMFCs) attract great attention due to high energy density and ... -
Microscopic, spectroscopic, and electrochemical characterization of novel semicrystalline poly(3-hexylthiophene)-based dendritic star copolymer
(MDPI, 2022)In this study, electron-donating semicrystalline generation 1 poly(propylene thiophenoimine)- co-poly(3-hexylthiophene) star copolymer, G1PPT-co-P3HT was chemically prepared for the first time. Copolymerization was ... -
Microscopic, spectroscopic, and electrochemical characterization of novel semicrystalline poly(3-hexylthiophene)-based dendritic star copolymer
(MDPI, 2022): In this study, electron-donating semicrystalline generation 1 poly(propylene thiophenoimine)- co-poly(3-hexylthiophene) star copolymer, G1PPT-co-P3HT was chemically prepared for the first time. Copolymerization was ... -
Microwave-assisted synthesis of schiff base metal–ligand complexes with copper and nickel centres for electrochemical in vitro sensing of nitric oxide in an aqueous solution
(MDPI, 2022)Nitric oxide (NO), the smallest signalling molecule known in the human body, keeps blood vessels dilated, controls blood pressure, and has numerous other health regulatory effects. The use of Schiff base complexes ... -
Nanostructured europium-doped layered lithium manganese oxide as a prospective cathode material for aqueous lithium-ion battery
(Elsevier, 2023)As the world moves to greener and renewable energy generation technologies, scientific researchers are facing a great challenge of concurrently developing energy storage materials with a low production cost, environmentally ... -
Nanostructured silicon derived from an agricultural residue bagasse ash via magnesiothermic reduction method
(MDPI, 2023)This study presents the magnesiothermic reduction of silica into silicon. This reduction process occurs at a lower reaction temperature than its carbothermal counterpart. Furthermore, silica was extracted from sugarcane ... -
Palladium-gold nanoalloy surface modified limn2o4 cathode for enhanced li-ion battery
(Hindawi, 2015)Au with Pd nanoparticles were synthesized and coated onto the spinel LiMn2O4 via a coprecipitation calcination method with the objective to improve the microstructure, conductivity, and electrochemical activities of ... -
Polyethylene glycol (peg-400): An efficient one-pot green synthesis and anti-viral activity of novel α-diaminophosphonates
(Taylor & Francis Online, 2019)An efficient and eco-friendly protocol has been accomplished for a series of novel a-diaminophosphonates by a one-pot, three-component system via Kabachnik-Fields reaction of 4,40 -methylenedianiline, a variety of ... -
The potential of leucosidea sericea against propionibacterium acnes
(Elsevier, 2014)The present study reports on the potential of Leucosidea sericea addressing acne vulgaris. Four known compounds namely phytol acetate, triacontanol, phytol and alpha kosin and one new compound namely, (E)-3,7,11,15-tetra ... -
Progress on perovskite materials for energy application
(Elsevier, 2021)Energy underlies the human development and welfare. Today energy depends on combustion of fossil fuels (coal, natural gas, oil) sources. These sources have not only led to severe environmental issues because it emits greenhouse ... -
Quantum dot nanotoxicity investigations using human lung cells and toxor electrochemical enzyme assay methodology
(American Chemical Society, 2017)Recent studies have suggested that certain nanomaterials can interfere with optically based cytotoxicity assays resulting in underestimations of nanomaterial toxicity. As a result there has been growing interest in the ... -
A review of the green synthesis of zno nanoparticles utilising Southern African indigenous medicinal plants
(MDPI, 2022)Metal oxide nanoparticles (NPs), such as zinc oxide (ZnO), have been researched extensively for applications in biotechnology, photovoltaics, photocatalysis, sensors, cosmetics, and pharmaceuticals due to their unique ... -
Role of the methoxy group in product formation via TiCl4 promoted 4-phenyldioxolane isomerizations
(ARKAT USA INC, 2010)The product distribution obtained from the TiCl4 initiated intramolecular isomerizations of 4- methoxyphenyl- and trimethoxyphenyldioxolanes at -78 oC, -30 oC and 0 oC provided insights into the important regiochemical ... -
Setting the baseline for the modelling of Kesterite solar cells: The case study of tandem application
(Elsevier, 2023)The Kesterite solar cells research landscape is at a crossroad and despite a much improved understanding of the limitations of this class of materials, the current performance deficit contrasts with the several other thin ... -
Silver–zinc oxide nanocomposite antiseptic from the extract of Bidens pilosa
(Springer, 2019)Silver nanoparticles (Ag-NPs), zinc oxide (ZnO-NPs) and zinc oxide–silver (ZnO–Ag-NPs) were biosynthesized based on the rich matrix of alkaloids, flavones, tannins capping/stabilizing agents present in Bidens pilosa ... -
Spectroscopy, morphology, and electrochemistry of electrospun polyamic acid nanofibers
(Frontiers Media, 2022)Polyamic acid (PAA) nanofibers produced by using the electrospinning method were fully characterized in terms of morphology and spectroscopy. A PAA nanofiber–modified screen-printed carbon electrode was applied to the ... -
Spray‐pyrolyzed Cd‐substituted kesterite thin‐films for photovoltaic applications: Post annealing conditions and property studies
(Elsevier, 2023)Kesterite materials were investigated for their suitability as absorber layers for thin-film photovoltaic cells. Thin- films of copper cadmium zinc tin sulfide (Cu2CdxZn1-xSnS4) were prepared by spray pyrolysis on soda-lime ...