Browsing Research Articles (Chemistry) by Subject "Silver nanoparticles"
Now showing items 1-6 of 6
-
Advances in nanotechnology towards development of silver nanoparticle-based wound-healing agents
(MPDI, 2021)Since antiquity, silver-based therapies have been used in wound healing, wound care and management of infections to provide adequate healing. These therapies are associated with certain limitations, such as toxicity, ... -
Dry Gongronema latifolium aqueous extract mediated silver nanoparticles by one-step in-situ biosynthesis for antibacterial activities
(Elsevier, 2021)In-situ biosynthesis of silver nanoparticles for antibacterial activities doped with aqueous extract of dry Gongronema Latifolium (DGL) is presented in this work. The absorbance was determined using a UV-Visible analysis ... -
Fabrication of silver‑coated PET track‑etched membrane as SERS platform for detection of acetaminophen
(Springer, 2021-09)In this study, silver nanoparticles (AgNPs) were immobilized on the surface of polyethylene terephthalate (PET) membrane using diethylenetriamine (DETA) as a chemical linker. The molecule of DETA was attached to the surface ... -
Green method synthesised graphene-silver electrochemical nanobiosensors for ethambutol and pyrazinamide
(MDPI, 2020)A novel nanobiosensor was constructed with graphene oxide (GO) sheets coupled to pear extract-based green-synthesised silver nanoparticles (Ag-NPs) to which cytochrome P450-2D6 (CYP2D6) enzyme was attached. The biosensor ... -
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR (L, L-leucine; R, L-arginine) (MC-LR) containing a 50 thiolated 60-mer DNA aptamer (i.e., 50 -SH- (CH2 )6GGCGCCAAACAGGACCACCATGAC ... -
Silver–zinc oxide nanocomposite antiseptic from the extract of Bidens pilosa
(Springer, 2019)Silver nanoparticles (Ag-NPs), zinc oxide (ZnO-NPs) and zinc oxide–silver (ZnO–Ag-NPs) were biosynthesized based on the rich matrix of alkaloids, flavones, tannins capping/stabilizing agents present in Bidens pilosa ...