Search
Now showing items 1-4 of 4
Dry Gongronema latifolium aqueous extract mediated silver nanoparticles by one-step in-situ biosynthesis for antibacterial activities
(Elsevier, 2021)
In-situ biosynthesis of silver nanoparticles for antibacterial activities doped with aqueous extract of dry Gongronema Latifolium (DGL) is presented in this work. The absorbance was determined using a UV-Visible analysis ...
Fabrication of silver‑coated PET track‑etched membrane as SERS platform for detection of acetaminophen
(Springer, 2021-09)
In this study, silver nanoparticles (AgNPs) were immobilized on the surface of polyethylene terephthalate (PET) membrane
using diethylenetriamine (DETA) as a chemical linker. The molecule of DETA was attached to the surface ...
Advances in nanotechnology towards development of silver nanoparticle-based wound-healing agents
(MPDI, 2021)
Since antiquity, silver-based therapies have been used in wound healing, wound care and
management of infections to provide adequate healing. These therapies are associated with certain
limitations, such as toxicity, ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...