Search
Now showing items 1-10 of 45
Crystal structure of saposin B reveals a dimeric shell for lipid binding
(National Academy of Sciences, 2003)
Saposin B is a small, nonenzymatic glycosphingolipid activator
protein required for the breakdown of cerebroside sulfates (sulfatides) within the lysosome. The protein can extract target lipids
from membranes, forming ...
1D NiHPO4 nanotubes prepared using dissolution equilibrium as bifunctional electrocatalyst for high-efficiency water splitting
(Journal of Power Sources, 2021)
In this work, one-dimensional NiHPO4 nanotubes are successfully fabricated on nickel foam by hydrothermal reaction, in which a dissolution equilibrium between phosphates is controlled by tuning the proportion of the mixed ...
The synthesis of 7,9-dimethoxy-3-propyl-3,4-dihydro-1H-benzo[g]isochromene1,5,10-trione: A potential monomer for the synthesis of the natural product xylindein
(Arkivoc, 2020)
A novel synthesis of a 3-propyl-substituted-benzo[g]isochromene quinone, a potential monomer of the
natural product xylindein, was accomplished in 9 steps (overall yield of 8.2%) from 2,4-
dimethoxybenzaldehyde. Key steps ...
Acylation of anisole with benzoyl chloride over rapidly synthesized fly ash–based hbea zeolite
(Frontiers Media, 2021)
Stable HBEA zeolite with high surface area and strong acid sites was synthesized from coal
fly ash–based silica extract via indirect hydrothermal synthesis. The rapid HBEA
hydrothermal crystallization times of 8, 10, and ...
Abundance of no3 derived organo-nitrates and their importance in the atmosphere
(MPDI, 2021)
The chemistry of the nitrate radical and its contribution to organo-nitrate formation in
the troposphere has been investigated using a mesoscale 3-D chemistry and transport model, WRFChem-CRI. The model-measurement ...
Impedimetric microcystin-lr aptasensor prepared with sulfonated poly(2,5-dimethoxyaniline)–silver nanocomposite
(MPDI, 2021)
This paper presents a novel impedimetric aptasensor for cyanobacterial microcystin-LR
(L, L-leucine; R, L-arginine) (MC-LR) containing a 50
thiolated 60-mer DNA aptamer (i.e., 50
-SH-
(CH2
)6GGCGCCAAACAGGACCACCATGAC ...
Spectroscopy, morphology, and electrochemistry of electrospun polyamic acid nanofibers
(Frontiers Media, 2022)
Polyamic acid (PAA) nanofibers produced by using the electrospinning method were fully
characterized in terms of morphology and spectroscopy. A PAA nanofiber–modified
screen-printed carbon electrode was applied to the ...
Microwave-assisted synthesis of schiff base metal–ligand complexes with copper and nickel centres for electrochemical in vitro sensing of nitric oxide in an aqueous solution
(MDPI, 2022)
Nitric oxide (NO), the smallest signalling molecule known in the human body, keeps
blood vessels dilated, controls blood pressure, and has numerous other health regulatory effects.
The use of Schiff base complexes ...
Synthesis and reactivities of conducting hexathienylbenzene-co-poly(3-hexylthiophene) star-branched copolymer as donor material for organic photovoltaic cell
(Frontiers Media, 2022)
The hexathienylbenzene-co-poly(3-hexylthiophene-2,5diyl) (HTB-co-P3HT) conducting
polymer was synthesized by oxidative co-polymerization of hexathienylbenzene (HTB)
and 3-hexylthiophene using iron chloride (FeCl3) as an ...
Fabrication of AgCu/TiO2 nanoparticle-based sensors for selective detection of xylene vapor
(Royal Society of Chemistry, 2022)
The design and fabrication of innovative nanostructured materials that could display improved sensitivity,
selectivity, and rapid response/recovery characteristics still present significant scientific challenges.
Herein ...